View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_105 (Length: 203)
Name: NF1504_1D_low_105
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_105 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 4395073 - 4395275
Alignment:
| Q |
1 |
aacattaggctcagaggaggcagataaaaaagaaagaaaataaatatactattgtgtagcaggtgatattgatgaattgcttttccaatatgggaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4395073 |
aacattaggctcagaggaggcagataaaaaagaaagaaaaaaaatatactattgtgtagtaggtgatatcgatgaattgcttttccaatatgggaatctg |
4395172 |
T |
|
| Q |
101 |
aaaaatccagcaaagtgatcaccgatgagctatataaaatgcagaccccaagaacaagtttactagcgtcaagaccaaaacaaaatactgagttttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395173 |
aaaaatccagcaaagtgatcaccgatgagctatataaaatgcagaccccaagaacaagtttactggcgtcaagaccaaaacaaaatactgagttttcttc |
4395272 |
T |
|
| Q |
201 |
cat |
203 |
Q |
| |
|
||| |
|
|
| T |
4395273 |
cat |
4395275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University