View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_106 (Length: 202)
Name: NF1504_1D_low_106
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_106 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 22858418 - 22858597
Alignment:
| Q |
15 |
ttggagtgtgctacaaatattcttggcttgaagagaagaaagagatgatggtaacgctgaagaaggaag---attccgagttcgggaacgaacctttttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22858418 |
ttggagtgtgctacaaatattcttggcttgaagagaagaaagcgatgatggtgacgccgaagaaggaagaagattccgagttcgggaacgaacctttttt |
22858517 |
T |
 |
| Q |
112 |
cgtttatgtttccgtcaaatttaacacgctacgttccagttactgttacgattcaaatagttgttgccggtttgtttcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22858518 |
cgtttatgtttccgtcaaatttaacacgctacgttccagttactgttacgattcaaatagttgttgccggtttgtttcat |
22858597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University