View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_16 (Length: 377)
Name: NF1504_1D_low_16
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 122 - 376
Target Start/End: Original strand, 19205969 - 19206220
Alignment:
| Q |
122 |
taagtgagcatgatgttaacaacactcttgaccagctgcactttgtcttctgtaggtaaaatagaagctttccatgagctagcttcaacttaatctcatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19205969 |
taagtgagcatgatgttaacaacactcttgcccagctgcactttgtcttctgtaggtaaaatagaagctttccatgagctagcttcaacttaatctcatc |
19206068 |
T |
|
| Q |
222 |
caccaaaggttgcnnnnnnnnngaattttgctctatagcagacaaagttggtagaagctttccatgtaatatatatattaataatattacaagcatcttt |
321 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19206069 |
caccaaaggttgaaaaaagaaggt-ttttgctctatagcagacaaagttggtagaagctttccatgtaatat--atattaataatattacaagcatcttt |
19206165 |
T |
|
| Q |
322 |
atttcgtgacaagtgtttcaccaccttcacttgatggatcccaactagggggttt |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19206166 |
atttcgtgacaagtgtttcaccaccttcacttgatggatcccaactagggggttt |
19206220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 303 - 376
Target Start/End: Complemental strand, 12408697 - 12408624
Alignment:
| Q |
303 |
taatattacaagcatctttatttcgtgacaagtgtttcaccaccttcacttgatggatcccaactagggggttt |
376 |
Q |
| |
|
||||||||||||||| ||||| |||| |||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12408697 |
taatattacaagcattattattgcgtgccaagagtttcaccaccttcacttgatggatcccaaccagggggttt |
12408624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University