View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_20 (Length: 349)
Name: NF1504_1D_low_20
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 253 - 348
Target Start/End: Complemental strand, 46093240 - 46093145
Alignment:
| Q |
253 |
attcgattttttattgctttacgtaagacaaggattgcataaaataatgggtagcacattggttggatatgaattaagtcaaatatgctctttttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46093240 |
attcgattttttattgctttacgtaagacaaggattgcataaaataatgggtagcacattggttggatatgaattaagtcaaatatactctttttt |
46093145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 46093389 - 46093330
Alignment:
| Q |
21 |
catcaaatgcgataactcgacgatgatggggcaatagtgcaaatacacttttgcatggtt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46093389 |
catcaaatgcgataactcgacgatgatggggcaatagtgcaaatacacttttgcatggtt |
46093330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 46093274 - 46093238
Alignment:
| Q |
168 |
caaaatatttaagtttttatgataattaagcaatatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46093274 |
caaaatatttaagtttttatgataattaagcaatatt |
46093238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University