View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_21 (Length: 347)
Name: NF1504_1D_low_21
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 274
Target Start/End: Complemental strand, 39214151 - 39213907
Alignment:
| Q |
22 |
gagatcgatgcttacaatgcggcgttgttgatgcttggtgctagcttgttacgataatggttgagacagaaatggaagagagaaacaagaagtctgtaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
39214151 |
gagatcgatgcttacaatgcggcgttgttgatgcttggtgctagcttgttacgataatggttgagacaaaaatggaagagagaaaaaagaagtttgtaga |
39214052 |
T |
|
| Q |
122 |
attgaatttgcactgtgagagtg-aaaatgaaaacagaaaagggaagagcttgagtcaaactatggtcttttgtgacgtgtgtgactggggttgggttgt |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
39214051 |
attgaatttgcactgtgagagtgaaaaatgaaaacagaaaagggaagagcttgagtcaaactatggtctct---------tgtgactggggttgggttgt |
39213961 |
T |
|
| Q |
221 |
tcagggactcagcatgggccgttaaagataacgacagaactaaatgtagtctaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39213960 |
tcagggactcagcatgggccgttaaagataacgacagaactaaatgtagtctaa |
39213907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University