View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_48 (Length: 269)
Name: NF1504_1D_low_48
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 48 - 265
Target Start/End: Complemental strand, 12157198 - 12156976
Alignment:
| Q |
48 |
caaatcatttggttgttgttgttgttattaggatttatgtcaaagtaagtgataggtcattgat-gtagt---ttcaagtgagaggtagtttcaacaggt |
143 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || || | ||||||||||||||||||||||| | |
|
|
| T |
12157198 |
caaattatttggttgttgttgttgttattaggatttatgtcaaagtaagtgataggtgcaagatagtcgtgagtccaagtgagaggtagtttcaacagct |
12157099 |
T |
|
| Q |
144 |
ggctagctagtgagcttttgaattatagcaacttggaggtcattgatgcacatttcttgtctcacacgccttaatttgtttttgaccaagtcagttttgt |
243 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
12157098 |
gactagctagtgagcttttgaattataccaacttgaaggtcattgatgtacatttcttgtctcacatgccttaatttgttttttaccaagtcagttttgt |
12156999 |
T |
|
| Q |
244 |
taactatattgct-caatcaacg |
265 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
12156998 |
taactatattgctccaatcaacg |
12156976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University