View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_49 (Length: 267)
Name: NF1504_1D_low_49
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 21128410 - 21128639
Alignment:
| Q |
16 |
atttaattgattgcttttgttttgttgttcaggttgtattaccagtacattccagagggaaaggaatatcctgtgatgtgtaggaagctggaaacagagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21128410 |
atttaattgattgcttttgttttgttgttcaggttgtattaccagtacattccagagggaaaggaatatcctgtgatgtgtaggaagctggaaacagagc |
21128509 |
T |
|
| Q |
116 |
gaagtggttggatgaatacatttttgcaccgccatggaatggcaggatctaaaagggaggaggttttgcttgactggaatgaactcgcagagaaatacgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21128510 |
gaagtggttggatgaatacatttttgcaccgccatggaatggcaggatctaaaagggaggaggttttgcttgactggaatgaactcgcagagaaatatgg |
21128609 |
T |
|
| Q |
216 |
taagttaccattcaacacaatatatggatg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21128610 |
taagttaccattcaacacaatatatggatg |
21128639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University