View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_60 (Length: 252)
Name: NF1504_1D_low_60
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 1048233 - 1047998
Alignment:
| Q |
17 |
gacatcacgtttttgaaggaatagaatctcgaggtggaatccgttgatgaaatgagaaccagcgacgtcttaagaggccaaaacgtagtacaaaaactca |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
1048233 |
gacatgacgtttttgaaggaatagaatctcgaggtggaatccgttgatgaaatgagaaccagcggcgtctcaagatgccataacgtagtacaaaaactca |
1048134 |
T |
|
| Q |
117 |
ttaaaacaaataatagattgaatg----gtatcaagtttgatggtgaagtggatattgggaacagaaagagatgttatttgtcgataatggtatcaaact |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048133 |
ttaaaacaaataatagattgaatgaatggtatcaagtttgatggtgaagtggatattgggaacagaaagagatgttatttgtcgataatggtatcaaact |
1048034 |
T |
|
| Q |
213 |
tagaatagattgaataaggctgggaatgattacttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048033 |
tagaatagattgaataaggctgggaatgattacttc |
1047998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University