View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_65 (Length: 244)
Name: NF1504_1D_low_65
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_65 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 25346625 - 25346398
Alignment:
| Q |
17 |
acatcactttttaatttgttgcagtccacattaatgcaaagttggtttggctgcaatttttgaaaatcagtatgtcacttagtgcatggggaagttttta |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25346625 |
acattactttttaatttgttgcagtccacattaatgcaaagttggtttggctgcaatttttgaaaatcagtatgtcacttagtgcatggggaagttttta |
25346526 |
T |
|
| Q |
117 |
ggggtagtaaaggattgttggaattacatgtgtgagactttttgttttggtgtttgtttcaatctgattttgattcaaatgagggagtatgatgaacaac |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25346525 |
ggggtagtaaaggattgttggtattacatgtgtgagacttttttttttggtgtttgtttcaatctgattttgattcaaatgagggagtatgatgaacaac |
25346426 |
T |
|
| Q |
217 |
ttttgttctgttttcaccttgtattgtt |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||| |
|
|
| T |
25346425 |
ttttgttctgtttttaccttgtattgtt |
25346398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University