View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_low_65 (Length: 244)

Name: NF1504_1D_low_65
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_low_65
NF1504_1D_low_65
[»] chr3 (1 HSPs)
chr3 (17-244)||(25346398-25346625)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 25346625 - 25346398
Alignment:
17 acatcactttttaatttgttgcagtccacattaatgcaaagttggtttggctgcaatttttgaaaatcagtatgtcacttagtgcatggggaagttttta 116  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25346625 acattactttttaatttgttgcagtccacattaatgcaaagttggtttggctgcaatttttgaaaatcagtatgtcacttagtgcatggggaagttttta 25346526  T
117 ggggtagtaaaggattgttggaattacatgtgtgagactttttgttttggtgtttgtttcaatctgattttgattcaaatgagggagtatgatgaacaac 216  Q
    ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25346525 ggggtagtaaaggattgttggtattacatgtgtgagacttttttttttggtgtttgtttcaatctgattttgattcaaatgagggagtatgatgaacaac 25346426  T
217 ttttgttctgttttcaccttgtattgtt 244  Q
    |||||||||||||| |||||||||||||    
25346425 ttttgttctgtttttaccttgtattgtt 25346398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University