View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_70 (Length: 238)
Name: NF1504_1D_low_70
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 65 - 214
Target Start/End: Complemental strand, 53041126 - 53040977
Alignment:
| Q |
65 |
tcttctattgtttggtctttcacgatctaccttgagtctagcaaagaattgccctgaaaggaagccaccggtcatataatctcaatcatgaaaactaagc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53041126 |
tcttctattgtttggtctttcacgatctagcttgagtctagcaaagaattgccctgaaaggaagccaccagtcatataatctcaatcatgaaaactaagc |
53041027 |
T |
|
| Q |
165 |
tttgaatagtctatagccgtcaatgatatttgcttcaattatctttttcc |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53041026 |
tttgaatagtctatagtcgtcaatgatatttgcttcaattatctttttcc |
53040977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University