View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_71 (Length: 237)
Name: NF1504_1D_low_71
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 231
Target Start/End: Complemental strand, 51359576 - 51359354
Alignment:
| Q |
9 |
agattctaacaagaatgatgcctattcttctaagtacaatactcatgaacacatgtttagcacaactacaaaccttttctgtccaacaaggaacctttat |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51359576 |
agattctaacaagaatgatgcctatccttctaagtacaatactcatgaacacatgtttagcacaactacaaaccttttctgtccaacaaggaacctttat |
51359477 |
T |
|
| Q |
109 |
gaacacattcattggcactttcaacattccagcagcatcaatacctgtgatcccatttgtattcatgatcattttgatacctgtttatgaatttgcattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51359476 |
gaacacattcattggcactttcaacattccagcagcatcaatacctgtgatcccatttgtattcatgatccttttgatacctgtttatgaatttgcattt |
51359377 |
T |
|
| Q |
209 |
gtaccacttgctcgcaaaattac |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51359376 |
gtaccacttgctcgcaaaattac |
51359354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 128
Target Start/End: Complemental strand, 51349747 - 51349648
Alignment:
| Q |
35 |
cttctaagtacaatactcatgaacacatgtttagca------caactacaaaccttttctgtccaacaaggaacctttatgaacacattcattggcactt |
128 |
Q |
| |
|
|||||| |||||||| |||||||||| |||||| || |||| ||||||||| || |||||||||||||| |||| ||||||||||||| ||||| |
|
|
| T |
51349747 |
cttctatgtacaataatcatgaacacgtgtttaacatagctacaacaacaaaccttctcggtccaacaaggaacttttaccaacacattcattgacactt |
51349648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 228
Target Start/End: Original strand, 18106602 - 18106645
Alignment:
| Q |
185 |
atacctgtttatgaatttgcatttgtaccacttgctcgcaaaat |
228 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18106602 |
atacatgtttatgaatttgcttttgtaccacttgctcgcaaaat |
18106645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 69 - 103
Target Start/End: Original strand, 18106545 - 18106579
Alignment:
| Q |
69 |
cacaactacaaaccttttctgtccaacaaggaacc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18106545 |
cacaactacaaaccttttctgtccaacaaggaacc |
18106579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University