View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_72 (Length: 237)
Name: NF1504_1D_low_72
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 80 - 203
Target Start/End: Complemental strand, 47513641 - 47513518
Alignment:
| Q |
80 |
gcatggagatggataacaataagtgtggatgttggtctgtccttaaacgtggtgtttgtaaaccctctacttctagacactctcctaactctatccctcg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
47513641 |
gcatggagatggataacaataagtgtggatgttggtctgtccttaaacgtggtgtttgtaaaccctctgcttctagacactctcctaacactatccctcg |
47513542 |
T |
 |
| Q |
180 |
tactagtgtcgttcatgatgcagg |
203 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47513541 |
tactagtgtcgttcatgatgcagg |
47513518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 81 - 119
Target Start/End: Complemental strand, 50944920 - 50944882
Alignment:
| Q |
81 |
catggagatggataacaataagtgtggatgttggtctgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50944920 |
catggagatggataacaataagtgtggatgttggtctgt |
50944882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University