View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_85 (Length: 223)
Name: NF1504_1D_low_85
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 205
Target Start/End: Original strand, 32452113 - 32452308
Alignment:
| Q |
9 |
tggtgttcacttattggttattttgaacttctactatagtttgcacttgttggttatgctataggttattgccattctaaacttcaaccatagtcttcac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
32452113 |
tggtgttcacttattggttattttgaacttctactatagtatgcacttattggttatgctataggttattgtcattctaaacttcagccatagtcttcac |
32452212 |
T |
 |
| Q |
109 |
ttattgataatgctataacttattgacatcttaagaactatgattgctcaactggcctatcccattaaattgtcatgataataatctgctaaagaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
32452213 |
ttattgataatgctataacttattgacatcttaagaactatgattgctcagctggcctatcctattaaa-tgtcatgataataatctgctaaagaag |
32452308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University