View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_2D_high_15 (Length: 204)
Name: NF1504_2D_high_15
Description: NF1504_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_2D_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 44 - 190
Target Start/End: Complemental strand, 363661 - 363515
Alignment:
| Q |
44 |
tgttttgttttacagagcacgacatcaatgagatctttggggatcttttagatgaaatttcttttttgtttattggtgattgctgtaattcaggagggct |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
363661 |
tgttttgttttacagagcacgacatcaatgagatctttggggatcttttagatgaaatttgttttttgtttattggtgattgctgtcattcaggagggct |
363562 |
T |
 |
| Q |
144 |
ccttggtggagcccgagaggaaggtggtgtcagtaaccttctccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
363561 |
ccttggtggagcccgagaggaaggtggtgtcagtaaccttctccctg |
363515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 353342 - 353374
Alignment:
| Q |
20 |
cgacctataactcaatgatttctatgttttgtt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
353342 |
cgacctataactcaatgatttctatgttttgtt |
353374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 10580122 - 10580154
Alignment:
| Q |
20 |
cgacctataactcaatgatttctatgttttgtt |
52 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
10580122 |
cgacctataactcaatggtttctatgttttgtt |
10580154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 41023636 - 41023720
Alignment:
| Q |
105 |
ttttttgtttattggtgattgctgtaattcaggagggctccttggtggagcccgagaggaaggtggtgtcagtaaccttctccct |
189 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |||| |||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
41023636 |
ttttttgtttattggtgatttctataattcaggagggcacctttgtggagcctaagaggcaggtggtgtcagtaaccttctccct |
41023720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 24578529 - 24578561
Alignment:
| Q |
20 |
cgacctataactcaatgatttctatgttttgtt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24578529 |
cgacctataactcaatgatttctatgttttgtt |
24578561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University