View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_2D_low_28 (Length: 234)
Name: NF1504_2D_low_28
Description: NF1504_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_2D_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 27554820 - 27555028
Alignment:
| Q |
19 |
actgtgctcatttggttgtaagccgaaacatttatggggaatttagtttatggtatgttgtctttaattaccttggagggatgtcctattatatcagcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27554820 |
actgtgctcatttggttgtaagccgaaacatttatggggactttagtttgtggtatgttgtctttaattaccttgaagggatgtcctattatatcagcat |
27554919 |
T |
|
| Q |
119 |
cattctagttattttaaacattaaatttgataacagttggtttatagtcttatttaggaat-tttttgcgatattacaccggagcaaagttaggggtttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27554920 |
cattctagttattttaaacattaaatttgataacagttggtttataatcttatttaggaatgtttttgcgatattacacaggagcaaagttaggggtttt |
27555019 |
T |
|
| Q |
218 |
ctcacacac |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
27555020 |
ctcacacac |
27555028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University