View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_2D_low_31 (Length: 224)
Name: NF1504_2D_low_31
Description: NF1504_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_2D_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 38627032 - 38626822
Alignment:
| Q |
1 |
tgttgatgtgtattttgttccgnnnnnnncttcgcttagttttaatacccatggccatcacatgagggatccggaaacggagattgatcatcaattgcag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38627032 |
tgttgatgtgtattttgttccgtttttttcttcgcttagttttaatacccatggccatcacatgagggatccggaaacggagattgatcatcaattgcag |
38626933 |
T |
 |
| Q |
101 |
gtatttgattcgtttaacccgactcgtctgctgtcattgcaagttccaacagcagtattgcatagaagttgcttgtgtatttgtctctaactgaatgtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626932 |
gtatttgattcgtttaacccgactcgtctgctgtcattgcaagttccaacagtagtattgcatagaagttgcttgtgtatttgtctctaactgaatgtga |
38626833 |
T |
 |
| Q |
201 |
cataaattgat |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
38626832 |
cataaattgat |
38626822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University