View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_2D_low_38 (Length: 203)
Name: NF1504_2D_low_38
Description: NF1504_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_2D_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 51 - 187
Target Start/End: Original strand, 14120061 - 14120197
Alignment:
| Q |
51 |
aacaaacataaaaagacggttcaatttatgtgcaagtgttttgatgtgtcatgcactttgttctcattcaacgaatgtaacattgcagtccaaggtatat |
150 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14120061 |
aacaaacataaaaggacggttcaatttatgtgtaagtgttttgatgtgtcatgcactttgttatcattcaacgaatgtaacattgcagtccaaggtatat |
14120160 |
T |
 |
| Q |
151 |
cttctcaactcaataatagagatataaggaacaaatt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14120161 |
cttctcaactcaataatagagatataaggaacaaatt |
14120197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University