View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15052_high_2 (Length: 330)
Name: NF15052_high_2
Description: NF15052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15052_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 113 - 292
Target Start/End: Complemental strand, 20629376 - 20629187
Alignment:
| Q |
113 |
tttgtcactccctcgtttcacgccgtcacccactcacccattcttcatttttcagtttctcactttacactgttaacaaatcgtctcc---tttttactc |
209 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||| ||| || | |
|
|
| T |
20629376 |
tttgtcactccctggtttcacgccttcacccactcacccattcttcatttttcagtttctcactttacactctcaacaaatcatctcaacatttctattt |
20629277 |
T |
|
| Q |
210 |
tc-------aacatgtgcccttgattagggcacaaattaacaccatccatccaatatataaatacaaataaaccgactcactcactcact |
292 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20629276 |
tcgttctttaacatgtgcccttgattagggcacaagttaacaccatccatccaatatataaatacaaataaaccgactcactcactcact |
20629187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 60 - 116
Target Start/End: Complemental strand, 20629466 - 20629410
Alignment:
| Q |
60 |
tagtaataataatgacaaattaatatcatttccaattacggtcacaaatagattttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20629466 |
tagtaataataatgacaaattaatatcatttccaattacggtcacaaatagattttg |
20629410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University