View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15052_high_4 (Length: 247)
Name: NF15052_high_4
Description: NF15052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15052_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 9 - 172
Target Start/End: Original strand, 11645882 - 11646045
Alignment:
| Q |
9 |
agatgaatccgataaccactttttaatattttgaagnnnnnnngttggaaatcagattctaaaacaatgaattgaatatgagattttgattttgtggcct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11645882 |
agatgaatccgataaccactttttaatattttgaagaaaaaaagttggaaatcagattctaaaacaatgaattgaatatgagattttgattttgtggcct |
11645981 |
T |
 |
| Q |
109 |
ctttatttttcattggcagtaatcttagagtaaattcgttagatgaatgagttccaagatcaaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11645982 |
ctttatttttcattggcagtaatcttagagtaaattcgttagatgaatgagttccaagaacaaa |
11646045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 188
Target Start/End: Original strand, 11646050 - 11646079
Alignment:
| Q |
159 |
gttccaagatcaaatggtttatgaaaatga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11646050 |
gttccaagatcaaatggtttatgaaaatga |
11646079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University