View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15052_low_10 (Length: 203)
Name: NF15052_low_10
Description: NF15052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15052_low_10 |
 |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 37602231 - 37602284
Alignment:
| Q |
1 |
ggcctatggttatgtgactattatcatgccatcaagtgatcaaatctttttcag |
54 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37602231 |
ggcctatggttacgtgactattgtcatgccatcaagtgatcaaatctttttcag |
37602284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 46558760 - 46558707
Alignment:
| Q |
1 |
ggcctatggttatgtgactattatcatgccatcaagtgatcaaatctttttcag |
54 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46558760 |
ggcctatggttacgtgactattgtcatgccatcaagtgatcaaatctttttcag |
46558707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 22778766 - 22778820
Alignment:
| Q |
1 |
ggcctatggttatgtgactattatcatgccatcaagtgatc-aaatctttttcag |
54 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
22778766 |
ggcctatggctatgtgactatcgtcatgccatcaagtgatcaaaatctttttcag |
22778820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 129 - 168
Target Start/End: Complemental strand, 16868 - 16829
Alignment:
| Q |
129 |
cttctagactcaattaaataattcgaaacggacattacac |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
16868 |
cttctagactcaattaaataattcgaaacgggcgttacac |
16829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 159
Target Start/End: Complemental strand, 27846704 - 27846676
Alignment:
| Q |
131 |
tctagactcaattaaataattcgaaacgg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27846704 |
tctagactcaattaaataattcgaaacgg |
27846676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University