View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15052_low_7 (Length: 221)

Name: NF15052_low_7
Description: NF15052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15052_low_7
NF15052_low_7
[»] chr7 (1 HSPs)
chr7 (95-143)||(44953332-44953380)
[»] chr2 (1 HSPs)
chr2 (108-147)||(34332340-34332379)


Alignment Details
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 95 - 143
Target Start/End: Complemental strand, 44953380 - 44953332
Alignment:
95 taggaaaaagatacatgtacaccccaatgtacaccctccatgtggcatg 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
44953380 taggaaaaagatacatgtacaccccaatgtacaccctccatgtggcatg 44953332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 108 - 147
Target Start/End: Complemental strand, 34332379 - 34332340
Alignment:
108 catgtacaccccaatgtacaccctccatgtggcatggcta 147  Q
    ||||||||||||||||||||||||||||||||||||||||    
34332379 catgtacaccccaatgtacaccctccatgtggcatggcta 34332340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University