View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15052_low_9 (Length: 204)
Name: NF15052_low_9
Description: NF15052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15052_low_9 |
 |  |
|
| [»] scaffold1297 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1297 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: scaffold1297
Description:
Target: scaffold1297; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 913 - 799
Alignment:
| Q |
70 |
tgcaaagaggtcttaataatgcaagaaaatatgtatatcatgccatcaccagaagcaaaatagagaaaaccagtgtttaaagaacataaaacaattggac |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
913 |
tgcaaagaggtcttaataatgcaagaaaatatgtatatcttgtcatcaccagaagctaaaaagagaaaaccagtgtttaaataacataaaacaattggac |
814 |
T |
 |
| Q |
170 |
gaagtaacatctgtc |
184 |
Q |
| |
|
| || |||||||||| |
|
|
| T |
813 |
ggagcaacatctgtc |
799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University