View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15053_high_19 (Length: 280)

Name: NF15053_high_19
Description: NF15053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15053_high_19
NF15053_high_19
[»] chr7 (1 HSPs)
chr7 (19-190)||(5518897-5519071)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 5519071 - 5518897
Alignment:
19 gccactcaaagattacaggaacagcagatttaagatagaataaacagtcaattgaagatactctaacagnnnnnnnttgtcactatttttagtcttgtaa 118  Q
    |||||||||||||||||||||| | ||||||||||||||||||| |||||||||| |||||||||| ||       | ||||||||||||||||||||||    
5519071 gccactcaaagattacaggaacggaagatttaagatagaataaatagtcaattgatgatactctaatagaaaaaagt-gtcactatttttagtcttgtaa 5518973  T
119 agaatgttgcaccaatttaatttcttccatatacataatcatttc----atattaagcaaaacaaatggtatgcaa 190  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    ||||||||  |||||||||||||||||    
5518972 agaatgttgcaccaatttaatttcttccatatacataatcgtttcatatatattaagtgaaacaaatggtatgcaa 5518897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University