View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15053_high_20 (Length: 276)
Name: NF15053_high_20
Description: NF15053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15053_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 32950557 - 32950796
Alignment:
| Q |
18 |
attttcttcatcttaagcctccaactgcttttacacttaagctgccttagtgatcctgggtggctggctgctttcgaacttcagttatcttagctttctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32950557 |
attttcttcatcttaagcctccaactgcttttaaacttaagctgccttagcgatcctgggtggctggcttctttcgaacttca-ttatcttagctttctg |
32950655 |
T |
 |
| Q |
118 |
ccttcggtcttcagctttctgcattctgtctttagctttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatcttcaaga |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950656 |
ctttcggtcttcagctttctgcattctgtctttagctttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatcttcaaga |
32950755 |
T |
 |
| Q |
218 |
ttttgaacttcagcgaaatctatctcttcaccgatcctcat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950756 |
ttttgaacttcagcgaaatctatctcttcaccgatcctcat |
32950796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University