View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15053_low_14 (Length: 387)
Name: NF15053_low_14
Description: NF15053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15053_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 47169943 - 47170125
Alignment:
| Q |
17 |
ataaggaagtaatcatagttgtcttcttagtgatcacaacccaaacaattcaattcaaccaaatcttcactcattattattataccaaattacggtttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47169943 |
ataaggaagtaatcatagttgtcttcttagtgatcacaacccaaacaattcaattcaaccaaatcttcactcattattattataccaaattacggtttaa |
47170042 |
T |
 |
| Q |
117 |
attattccatttcccaaaataagttttcaacaccattttttcctataaaaagaccaaccagactctcaacttttcatcacact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170043 |
attattccatttcccaaaataagttttcaacaccattttttcctataaaaagaccaaccagactctcaacttttcatcacact |
47170125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 261 - 380
Target Start/End: Original strand, 47170179 - 47170298
Alignment:
| Q |
261 |
tgtctggttgggctattgctgttcatggcggcgcaggtgtggatcctaacctgccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgtct |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170179 |
tgtctggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgtct |
47170278 |
T |
 |
| Q |
361 |
caatctcggtatctctgctc |
380 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47170279 |
caatctcggtatctctgctc |
47170298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 351
Target Start/End: Complemental strand, 42165733 - 42165647
Alignment:
| Q |
265 |
tggttgggctattgctgttcatggcggcgcaggtgtggatcctaacctgccaccacaccgtcagcaagaagccaaacagcttcttac |
351 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||||||||| || |||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
42165733 |
tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttac |
42165647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University