View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15053_low_17 (Length: 335)
Name: NF15053_low_17
Description: NF15053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15053_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 157 - 247
Target Start/End: Complemental strand, 3420301 - 3420211
Alignment:
| Q |
157 |
gttcctaatagtctttcatttgttgcaaagaaagattaaatttaaaagcatattcatgatattcagatattgtatgcatgcgtcttcctaa |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3420301 |
gttcctaatagtctttcatttgtttcaaagaaagatcaaatttaaaagcatattcatgatattcagatattgtatgcatgtgtcttcctaa |
3420211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 177 - 319
Target Start/End: Original strand, 43372941 - 43373084
Alignment:
| Q |
177 |
tgttgcaaagaaagattaaatt-taaaagcatattcatgatattcagatattgtatgcatgcgtcttcctaatacgtttatgaaattgtaggcattggta |
275 |
Q |
| |
|
|||| ||||||| ||||| ||| ||||| ||||||| |||||||||||||||||||||| | |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43372941 |
tgtttcaaagaatgattacattctaaaatcatattcttgatattcagatattgtatgcacacttcttcctaatacatttatgaaattgcaggcattggta |
43373040 |
T |
 |
| Q |
276 |
atcattgagcagtctttttattttccttactgaagtattacttt |
319 |
Q |
| |
|
||| || ||| |||||||||||| ||||||| | |||||||||| |
|
|
| T |
43373041 |
atctttcagcggtctttttatttcccttacttatgtattacttt |
43373084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University