View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15054_high_13 (Length: 263)
Name: NF15054_high_13
Description: NF15054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15054_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 30897546 - 30897790
Alignment:
| Q |
19 |
gtgggtagggcaaatcaccagtgagaagatcatcactgctgaagagggccattgctattgggtgtatttcaccactagctcagagacgaattactaccgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30897546 |
gtgggtagggcaaatcaccagtgagaagatcatcactgctgaagagggccattgctattgggtgtatttcagcactagctcagagacgaattactaccgc |
30897645 |
T |
|
| Q |
119 |
tatgatcagatcagagttcatcatgagtggtttggtggagagtggatcttggatg---------cataattcatgattataaacattgctcttgttttat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30897646 |
tatgatcagatcagagttcatcatgagtggtttggtggagagtggatcttggatgcataattgtcataattcatgattataaacattggtcttgttttat |
30897745 |
T |
|
| Q |
210 |
gtattttgaattggttattggcaataaacttcagtctcttcattt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30897746 |
gtattttgaattggttattggcaataaacttcagtctcttaattt |
30897790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University