View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15054_low_13 (Length: 316)
Name: NF15054_low_13
Description: NF15054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15054_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 36 - 299
Target Start/End: Original strand, 592691 - 592952
Alignment:
| Q |
36 |
tattgatatcataaaatgacatataatttagaataannnnnnnnngcgcaaggtgttgctgcaaatcttggattgaattggacaacaaaccatgaataca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | |||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
592691 |
tattgatatcataaaatgacatataatt-agaacattttttttttgcgcaaggtgttgctgcaaatcctagattgaattggacaacaaaccatgaataca |
592789 |
T |
|
| Q |
136 |
agctcaactaaagtgaaattatgtggcatgaataatgtacctttggatatttatccgatatcaaatcatattgatatattcaccactactgaatgcaaca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
592790 |
agctcaactaaagtgaaattatgtggcatgaataatgtacctttggatatttatccgatatcaaatcatattgatatattcaccactactgaatgcaaca |
592889 |
T |
|
| Q |
236 |
ctaattattttagtcagtatagaaattaaaatttatttgcctattgtgattaatttttcaaaat |
299 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
592890 |
ctaatta-tttagtcagtatagaaattaaaatttatttgcctattgtgattattttttcaaaat |
592952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University