View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15054_low_18 (Length: 247)
Name: NF15054_low_18
Description: NF15054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15054_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 8021618 - 8021383
Alignment:
| Q |
1 |
ttgatatttactgtcagtgtaatgaatttttatactgtcagtttaatcattatccttgaatcattacaaatatttgactttaactagatctaccttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8021618 |
ttgatatttactgtcagtgtaatgaatttttatactgtcagtttaatcattatccttgaatcattacaaatatttgactttaactagatctaccttaaaa |
8021519 |
T |
|
| Q |
101 |
gtcatatacataataannnnnnnnattggttgacagtttaaaaagttttatgctgatggtgcattaaaattaatctcttatataatatagaagggtgaaa |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8021518 |
gtcatatacataataattttttttattggttgacagtttaaaaagttttatgctgatggtgcattaaaattaatctcttatataatatagaagggtgaaa |
8021419 |
T |
|
| Q |
201 |
ataaccttcaagagaagcattaaccttctccttcat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8021418 |
ataaccttcaagagaagcattaaccttctccttcat |
8021383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 108
Target Start/End: Complemental strand, 22237842 - 22237802
Alignment:
| Q |
68 |
aaatatttgactttaactagatctaccttaaaagtcatata |
108 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
22237842 |
aaatatttgactttaatcatatctaccttaaaagtcatata |
22237802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University