View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15054_low_24 (Length: 208)
Name: NF15054_low_24
Description: NF15054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15054_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 4840553 - 4840364
Alignment:
| Q |
15 |
ttgtctgtgtgatgtatttatctggagtggtttg-aggcattgttatatattattgtattatttagcatttgtgagtaaaaatcagtctatctattgtga |
113 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4840553 |
ttgtttgtctgatgtatttatctggagtggtttggaggcattgttatatattattgtattatttagcatttgtgagtaaaaatcagtctatctattgtga |
4840454 |
T |
 |
| Q |
114 |
gtaaaaatccacgtctatttatatcccaactaagt--tatacttttggatttgtataaaatattcaagggaaaaaacaattagctctctg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4840453 |
gtaaaaatccacgtctatttatatcccaactaagttatatacttttggatttgtataaaatattcaagggaaaaaacaattagctctctg |
4840364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 15 - 84
Target Start/End: Original strand, 5174969 - 5175039
Alignment:
| Q |
15 |
ttgtctgtgtgatgtatttatctggagtggtttg-aggcattgttatatattattgtattatttagcattt |
84 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174969 |
ttgtttgtgtgatgtatttatctggagtggtttggaggcattgttatatattattgtattatttagcattt |
5175039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University