View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15054_low_8 (Length: 410)
Name: NF15054_low_8
Description: NF15054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15054_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 216 - 400
Target Start/End: Original strand, 49209401 - 49209585
Alignment:
| Q |
216 |
aagtgtttttgtacacaaaaccaatttaaataaacttgattttgtaaaaagagtatagtatgaaaatgagtttataagtgacatgcattcctaatcttac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49209401 |
aagtgtttttgtacacaaaaccaatttaaataaacttgattttgtaaaaagagtatagtatgaaaatgagtttataagtgacatgcattcctaatcttac |
49209500 |
T |
|
| Q |
316 |
agtatattgatttctcttgagatattttttactaaataaaaggcttatagtgatgcaacttattatctgtttgtcttcttctcac |
400 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49209501 |
agtatactgatttctcttgagatattttttactaaataaaagacttatagtgatgcaacttattatctgtttgtcttcttctcac |
49209585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 49209203 - 49209332
Alignment:
| Q |
18 |
gaaatgaatgagttggaatgctttttggcatgcctttgtctttgttgtgtactatgagggtggaacactcatcattctgtcattttcaaatcttccaccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49209203 |
gaaatgaatgagttggaatgctttttggcatgcctttgtctttgttgtgtactatgagggtggaacactcatcattctgtcattttcaaatcttccaccc |
49209302 |
T |
|
| Q |
118 |
acgcatcttcactttttctatataattata |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49209303 |
acgcatcttcactttttctatataattata |
49209332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University