View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15054_low_9 (Length: 362)
Name: NF15054_low_9
Description: NF15054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15054_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 173 - 351
Target Start/End: Complemental strand, 25249391 - 25249213
Alignment:
| Q |
173 |
ttttcacgaatatctcatgatttatggttaaatattgaaatcttattttgatcggccgaaagggcaatgttgtttatcgtgagagtatttttcacgaatg |
272 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25249391 |
ttttcacgaaaatctcatgatttatggttaaatattgaaatcttgttttgatcggccgaaagggcaatg-tgtttatcatgagagtatttttcacgaatg |
25249293 |
T |
|
| Q |
273 |
tctcagtatttacggttaactagagaaa-agtgaaattttgtttctcgtcggccgaaaaacacaatagttattgagtata |
351 |
Q |
| |
|
||||| |||||| ||||||||| |||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
25249292 |
tctcatgatttaccgttaactagtgaaatagtgaaattttgtttctggtcggccgaaaaacacaataggtattgagtata |
25249213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 17 - 144
Target Start/End: Complemental strand, 25249543 - 25249416
Alignment:
| Q |
17 |
cattattggtgtaaacaagtttgatactgacgtacaatgaaactctgttgttttgttacattatttcccttttataagtatgctgaaatttattgtatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25249543 |
cattattggtgtaaacaagtttgatactgacatacaatgaaactctgttgttttgttacatcatttcccttttataagtatgctgaaatttattgtatgt |
25249444 |
T |
|
| Q |
117 |
caaaatacaaagcgcaatgctatttatc |
144 |
Q |
| |
|
|||||||||||| |||||||||| |||| |
|
|
| T |
25249443 |
caaaatacaaagggcaatgctatgtatc |
25249416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University