View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15055_high_18 (Length: 246)
Name: NF15055_high_18
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15055_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 42787756 - 42787527
Alignment:
| Q |
1 |
aagtttggaatattaagagggtatatttgcaaacctgagccttgctagttgaggttgtaacattaagagatgcttgttcaagttccataaatatggctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42787756 |
aagtttggaatattaagagggtatatttgcaaacctgagccttgctagttgaggttgtaacattaagagatgcttgttcaagttccataaatatggctac |
42787657 |
T |
 |
| Q |
101 |
nnnnnnncacatgtttgtcaactaaaactatgtatttttgtgtatcatttatttattactagtannnnnnnnncatgtcaagtactagtactgtatattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42787656 |
tttttttcacatgtttgtcaactaaaactatgtatttttgtgtatcatttatttattactagtatttttttttcatgtcaagtactagtactgtatattt |
42787557 |
T |
 |
| Q |
201 |
attgtataagaatgaattgaatcatatagt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42787556 |
attgtataagaatgaattgaatcatatagt |
42787527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University