View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15055_high_22 (Length: 211)
Name: NF15055_high_22
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15055_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 10518777 - 10518596
Alignment:
| Q |
12 |
agcataggaagagattactgtttggaacaagagtggttgtatcgaaggaaatggagaagagtggtgatggtggaaaagtttttgagaaagttgaattggg |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10518777 |
agcatacgaagagattactgtttggaacaagagtggttgtttcgaaggaaatggagaagagtggtgatggtggaaaagtttttgagaaagttgaattggg |
10518678 |
T |
|
| Q |
112 |
tgagtatgaatggttatcgtatgatgaagcttttgatagtgttgtcaagtttgctagtggtttggctgtgttgggacatgga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10518677 |
tgagtatgaatggttatcgtatgatgaagcttttgatagtgttgtcaagtttgctagtggtttggctgtgttgggacatgga |
10518596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University