View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15055_high_23 (Length: 211)
Name: NF15055_high_23
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15055_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 29425548 - 29425462
Alignment:
| Q |
19 |
atcaaaataaaatacataaataaattgagaacttttttatcctaccaaagtttgcatatacattttattttgttttagataaagtggta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
29425548 |
atcaaaataaaatacataaataaattgagaactttg--atcctaccaaagtttgcatatacattttattttgtcttagatgaagtggta |
29425462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 192
Target Start/End: Complemental strand, 29424981 - 29424926
Alignment:
| Q |
137 |
tttttaagaggcacgaaatttagaatttatgaccaataatctcatatttaaccttt |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
29424981 |
tttttaagaggcacgaaatttaaaatttatgagcaataatctcatatttaaccttt |
29424926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University