View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15055_low_20 (Length: 254)
Name: NF15055_low_20
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15055_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 21 - 169
Target Start/End: Original strand, 26185274 - 26185422
Alignment:
| Q |
21 |
acttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactatgttacgttgttatattactttatagtaaattatttcaacaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185274 |
acttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactatgttacgttgttatattactttatagtaaattatttcaacaaa |
26185373 |
T |
|
| Q |
121 |
catctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185374 |
catctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt |
26185422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 194 - 233
Target Start/End: Original strand, 26185415 - 26185454
Alignment:
| Q |
194 |
ttagccttgcattttttatctttttatttcatatcatgtt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185415 |
ttagccttgcattttttatctttttatttcatatcatgtt |
26185454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University