View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15055_low_23 (Length: 237)
Name: NF15055_low_23
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15055_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 12133175 - 12133255
Alignment:
| Q |
1 |
atgccactgtcaaagattgattagaataataagattgtaatagatgctgacccaagtaacctgtgcctcccacaatcaata |
81 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12133175 |
atgccactgtcagagattgattagaataataagattgtaatagatgctgacccaagtaacctgtgcctcccacaatcaata |
12133255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 180
Target Start/End: Original strand, 12133316 - 12133354
Alignment:
| Q |
142 |
acgttgtagtaattgtaatggtcaatgttttgtgtctga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12133316 |
acgttgtagtaattgtaatggtcaatgttttgtgtctga |
12133354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University