View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15055_low_26 (Length: 211)

Name: NF15055_low_26
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15055_low_26
NF15055_low_26
[»] chr8 (2 HSPs)
chr8 (19-107)||(29425462-29425548)
chr8 (137-192)||(29424926-29424981)


Alignment Details
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 29425548 - 29425462
Alignment:
19 atcaaaataaaatacataaataaattgagaacttttttatcctaccaaagtttgcatatacattttattttgttttagataaagtggta 107  Q
    |||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| |||||| ||||||||    
29425548 atcaaaataaaatacataaataaattgagaactttg--atcctaccaaagtttgcatatacattttattttgtcttagatgaagtggta 29425462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 192
Target Start/End: Complemental strand, 29424981 - 29424926
Alignment:
137 tttttaagaggcacgaaatttagaatttatgaccaataatctcatatttaaccttt 192  Q
    |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||    
29424981 tttttaagaggcacgaaatttaaaatttatgagcaataatctcatatttaaccttt 29424926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University