View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15055_low_7 (Length: 453)
Name: NF15055_low_7
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15055_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 39307464 - 39307270
Alignment:
| Q |
20 |
atgtaggccattgtcatatatttgtggtaccttacttggtttttt-ctttggttttgcacttgatcttatgtatggtttgggacagtttatatagtacat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307464 |
atgtaggccattgtcatatatttgtggtaccttacttggtttttttctttggttttgcacttgatcttatgtatggtttgggacagtttatatagtacat |
39307365 |
T |
 |
| Q |
119 |
gtatgtattatgatgcaatagttttattctaataaagtagtctttaattaaaaagcacctactttgaaaagaaacagttgcaaaatttcagcata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307364 |
gtatgtattatgatgcaatagttttattttaataaagtaccttttaattaaaaagcacttactttgaaaagaaacagttgcaaaatttcagcata |
39307270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 300 - 445
Target Start/End: Complemental strand, 39307183 - 39307038
Alignment:
| Q |
300 |
gtacaatgctagctatgagagcacccatggtgctatcaggtaaggtgataatagcatatgcaactcatgaggttcaacttagaagtgtgatttttactga |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307183 |
gtacaatgctagctatgagagcacccatggtgctatcaggtaaagtgataatagtatatgcaactcatgaggttcaacttagaagtgtgatttttactga |
39307084 |
T |
 |
| Q |
400 |
aaaatgattattatctacctttctgtcttttatttctcttcatctc |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307083 |
aaaatgattattatctacctttctgtcttttatttctcttcatctc |
39307038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University