View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15056_low_18 (Length: 245)
Name: NF15056_low_18
Description: NF15056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15056_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 5461818 - 5462047
Alignment:
| Q |
1 |
cattttcgaccgtatcatccatatttt-tctacaatataaaggtttctagcataatggcagccatggttttaaatcccggtactcaaccacaattgttgc |
99 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461818 |
cattttcgaccgtaccatccatattttttctacaatataaaggtttctagcataatggcagccatggttttaaatcccggtactcaaccacaattgttgc |
5461917 |
T |
 |
| Q |
100 |
cacaatataacaaattttgaggtctatgcaatataaagtttcatagcataactgcaaccatggttttaaactgtggttcgcaaccataattgcagccaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5461918 |
cacaatataacaaattttgaggtctatgcaatataaagtttcatagcataactgcaaccatggttttcaactgtggttcgcaaccataattgcagccaca |
5462017 |
T |
 |
| Q |
200 |
atacaatagattttgaggtctctttgcaat |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
5462018 |
atacaatagattttgaggtctcttttcaat |
5462047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 29277021 - 29277084
Alignment:
| Q |
157 |
ccatggttttaaactgtggttcgcaaccataattgcagccacaatacaatagattttgaggtct |
220 |
Q |
| |
|
||||||||||||| || ||| |||||||||||| |||||| ||||| | |||||||||||||| |
|
|
| T |
29277021 |
ccatggttttaaattgcggtccgcaaccataatcgcagcctcaatatcaaagattttgaggtct |
29277084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University