View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15056_low_4 (Length: 461)
Name: NF15056_low_4
Description: NF15056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15056_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 346 - 443
Target Start/End: Original strand, 30725696 - 30725793
Alignment:
| Q |
346 |
tgctgcccttgctgaaacatggaataggagtgcatcacactgagttactcccaattctaaaggaagtgattgagatcttatttcaagaaggactaatc |
443 |
Q |
| |
|
|||| |||||||| |||| |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30725696 |
tgctacccttgctcaaacgtggaataggagtacatcactctggtttactcccaattctaaaggaagtgattgagatcttgtttcaagaaggtctaatc |
30725793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University