View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15057_high_10 (Length: 229)
Name: NF15057_high_10
Description: NF15057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15057_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 33961584 - 33961381
Alignment:
| Q |
16 |
aaataggcaaatcttgtgagttttagtctcccttaaggattatactcctaacatctttgcacctcttttatagtgtcaaatcatcaacattcttaagctt |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33961584 |
aaataggcaaatcttg--agttttagtctcccttaaggattatactcctaacatctttgcacctcttttattgtgtcaaatcatcaacattcttaagctt |
33961487 |
T |
|
| Q |
116 |
tagattg--------caaaattccaatttcactcattcaattgcctacagtttcatgaaataataaacatgcaagtgatgcatgcaacaactacaatctc |
207 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33961486 |
tagattgcgaaattccaaaattccaatttcactcattcaattgcctacagtttcatgaaataataaacatgcaagtgatgcatgcaacaactacaatctc |
33961387 |
T |
|
| Q |
208 |
atttct |
213 |
Q |
| |
|
|||||| |
|
|
| T |
33961386 |
atttct |
33961381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University