View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15057_low_14 (Length: 208)
Name: NF15057_low_14
Description: NF15057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15057_low_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 27770238 - 27770443
Alignment:
| Q |
1 |
cctaattaacaagattttattttctttggtttcaactcaatcaaaacatgaacggtctgaatcat---attaattaataaccgagtaatgttgtagacaa |
97 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
27770238 |
cctaattaacaagattttattttgtttggtttcaactcaatcaaaacaagaacggtctgaatcatctgattaattaataaccgagaaatgttgtagacaa |
27770337 |
T |
 |
| Q |
98 |
ggatcatcttccttaatagtaggaaagacacatatgtttctttctacatctctgatctcctgaccctcactccctctctct--cacacactcaaaggata |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
27770338 |
ggatcatcttccttaatagtaggaaagacacata--tttctttttacatctctgatct-----ccctccctccctctctctcacacacactcaaaggata |
27770430 |
T |
 |
| Q |
196 |
gaggatctaattc |
208 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
27770431 |
gaggatccaattc |
27770443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University