View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15057_low_15 (Length: 203)
Name: NF15057_low_15
Description: NF15057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15057_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 3 - 152
Target Start/End: Complemental strand, 5854966 - 5854817
Alignment:
| Q |
3 |
cattcatgttaaagatgagttcatgcatctataaatagtaaaagataaataaacgattttgatcggtgtcaacttagtatggatagagttccacaccatt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
5854966 |
cattcatgttaaagatgagttcatgcatctataaatagtaaaagacaaataaacgattttgattggtgtcaactcagtatggatagagttacacaccatt |
5854867 |
T |
|
| Q |
103 |
atcgatggataaataagaatttctcatctattattatatttctcattata |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5854866 |
atcgatggataaataagaatttctcatctattattatatttctcattata |
5854817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 81
Target Start/End: Complemental strand, 44858653 - 44858613
Alignment:
| Q |
41 |
taaaagataaataaacgattttgatcggtgtcaacttagta |
81 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44858653 |
taaaagataaataaattattttgattggtgtcaacttagta |
44858613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 34547171 - 34547211
Alignment:
| Q |
33 |
ataaatagtaaaagataaataaacgattttgatcggtgtca |
73 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
34547171 |
ataaataggaaaagataaatgaatgattttgatcggtgtca |
34547211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University