View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15057_low_4 (Length: 431)
Name: NF15057_low_4
Description: NF15057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15057_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 5e-35; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 206 - 347
Target Start/End: Complemental strand, 47439981 - 47439827
Alignment:
| Q |
206 |
tatttcaaacgggccaaactttttgtttattaaa-taaaggtgcttataaaattttatctatat-------------ataaacggaatacaaaattttga |
291 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
47439981 |
tatttcaaacgggccaaactttttgtgtattaaaataaaggtgcttataaaatttcatctatatctatactatatatataaagggaatacaaaattttga |
47439882 |
T |
|
| Q |
292 |
attgactttttcaccttcagttatacacttaagcaaattttgtctcattcaaaaag |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
47439881 |
attgactttttcactttcagttatacac-taagcaaattttgtgtcattcaaaaag |
47439827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 47440029 - 47439977
Alignment:
| Q |
21 |
ctagaaactttttaacgaaaaattaggaaagtaatcgttatccaattatattt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47440029 |
ctagaaactttttaacgaaaaattaggaaagtaatcgttatccaattatattt |
47439977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 264 - 310
Target Start/End: Original strand, 35338291 - 35338337
Alignment:
| Q |
264 |
tatatataaacggaatacaaaattttgaattgactttttcaccttca |
310 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
35338291 |
tatatataaagggaatacataattttgaattaactttttcactttca |
35338337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 260 - 304
Target Start/End: Complemental strand, 1137402 - 1137358
Alignment:
| Q |
260 |
tatctatatataaacggaatacaaaattttgaattgactttttca |
304 |
Q |
| |
|
||||||||||| || ||||||||| |||||||||||| ||||||| |
|
|
| T |
1137402 |
tatctatatatgaagggaatacaagattttgaattgagtttttca |
1137358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University