View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15057_low_6 (Length: 340)
Name: NF15057_low_6
Description: NF15057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15057_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 16 - 323
Target Start/End: Complemental strand, 49320908 - 49320596
Alignment:
| Q |
16 |
ctctcctatatttagcacaaagaacttggactctagattttggtctcactctcacccaccatcaagaaccaaccaaacttcataatgtacgcatgattcg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49320908 |
ctctcctatatttagcacaaagaacttggactctagattttggtctcactctcacccaccatcaagaaccaaccaaacttcataatgtacgcatgattca |
49320809 |
T |
|
| Q |
116 |
taggttgtgatctgca-aagacctgaaccttctaaactcttagggagagtaacaatattccaattaatcata----nnnnnnnnnnaatcttcttcacca |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49320808 |
taggttgtgatctgcacaagacctgaaccttctaaactcttagggagagtaacaatattccaattaatcatatgtttttttttttttatcttcttcacca |
49320709 |
T |
|
| Q |
211 |
tcaccccatattaaacctctctggattttttcaacctcatgcatgtaacttattggaattttcatggacatcgtatgataatcaaggatggttgaaaaac |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49320708 |
tcaccccatattaaacctctctggattttttcaacctcatgcatgtaacttattggaattttcatggacatcgtatgataatcaaggatggttgaaaaac |
49320609 |
T |
|
| Q |
311 |
ttctttagataaa |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49320608 |
ttctttagataaa |
49320596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University