View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15058_high_1 (Length: 310)
Name: NF15058_high_1
Description: NF15058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15058_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 45548696 - 45548990
Alignment:
| Q |
1 |
ccttataacatcatatttttcgataaatgcagatgtctcatcattccaacctaaatcccacatgcaatctatgtcaggccatttttcgtagatatcatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45548696 |
ccttataacatcatatttttcgataaatgcagatgtctcatcattccaacctaaatcccacatgcaatctatgtcaggccatttttcatagatatcatgc |
45548795 |
T |
 |
| Q |
101 |
tcaagcatcttaggcaggtagtcctcaacatcaactttgctactctttttccttccgtagaatttaatcttctccatgtcctcgttcagcttcttaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548796 |
tcaagcatcttaggcaggtagtcctcaacatcaactttgctactctttttccttccgtagaatttaatcttctccatgtcctcgttcagcttcttaacca |
45548895 |
T |
 |
| Q |
201 |
agtcatctagagatcttatcaagttaacagtactagtgattgatgatatttttgaacaagtatgaattttgagttcctgccgtatcccctttctt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45548896 |
agtcatctagagatcttatcaagttaacagtactagtgattgatgatatttttgaacaagtatgaactttgagttcctgccgtatcccctttctt |
45548990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University