View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15059_high_3 (Length: 215)
Name: NF15059_high_3
Description: NF15059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15059_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 200
Target Start/End: Complemental strand, 17108829 - 17108642
Alignment:
| Q |
13 |
caagaatatgattgatgaaggtcaatagagcagaagtggattccccttccacccaaacatgataccagccgtgctgaaatgcatattttaatcccaagat |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17108829 |
caagaatatgattcatgaaggtcaatagagaagaagtggattcgccttccacccaaacatgataccagccgtgctgaaatgcatattttaatcccaagat |
17108730 |
T |
|
| Q |
113 |
aaagttgtgcagttctgcctcaattaccgaactcgaacccaaattagaagcaaaacagcctaaaaatgaacctctacaatctcaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
17108729 |
aaagttgtgcagttctgcctcaattaccgaactcgaccccaaattagcagcaaaacagcctaaaaaagaacctctataatctcaaaaa |
17108642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 185
Target Start/End: Complemental strand, 43691884 - 43691804
Alignment:
| Q |
105 |
cccaagataaagttgtgcagttctgcctcaattaccgaactcgaacccaaattagaagcaaaacagcctaaaaatgaacct |
185 |
Q |
| |
|
||||| |||||||||| || |||||| ||||| |||||||| | | || ||||||||||||||| |||||||| |||||| |
|
|
| T |
43691884 |
cccaaaataaagttgttcaattctgcttcaataaccgaactaggcctcatattagaagcaaaacatcctaaaaaagaacct |
43691804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University