View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_high_39 (Length: 239)
Name: NF1505_high_39
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_high_39 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 39527269 - 39527051
Alignment:
| Q |
19 |
tccctacctctctttgtgttttctattgtacactatgctctgtttgcttgtggaattagtttgcttagnnnnnnnatatcaaactatgcggcataaatca |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39527269 |
tccctacctctct--gtgttttctattgtacactatgctctgtttgcttgtggaattagtttgcttagttttttaatatcaaactatgcggcataaatca |
39527172 |
T |
 |
| Q |
119 |
aattataaccattaaatttcttagcaagctgttctgatgcagatcggcaatcatttcttaacactaacaagtgggttgaggaggtacgtgcagaacgagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39527171 |
aattataaccattaaatttcttagcaagctgttctgatgcagatcggcaatcatttcttaacactaacaagtgggttgaggaggtacgtgcagaacgagg |
39527072 |
T |
 |
| Q |
219 |
cagtgatgttattatcgtttt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39527071 |
cagtgatgttattatcgtttt |
39527051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 37852992 - 37852926
Alignment:
| Q |
164 |
ggcaatcatttcttaacactaacaagtgggttgaggaggtacgtgcagaacgaggcagtgatgttat |
230 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||| |||||| || ||||||||||| |
|
|
| T |
37852992 |
ggcaatcatttctgaacactaacaagtgggttgaggaggtgcgtcaagaacgtggtagtgatgttat |
37852926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University