View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_high_40 (Length: 238)
Name: NF1505_high_40
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_high_40 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 18717443 - 18717661
Alignment:
| Q |
17 |
agatatcctacggataccttgcaatgtcttttttggcaacaatgagaaaacattagcaacttctatacataatataactatgttacatgatgtggtttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18717443 |
agatatcctacggataccttgcaatgccttttttggcaacaatgagaaaacattagcaacttctatacataatataactatgttacatgatgtggtttct |
18717542 |
T |
|
| Q |
117 |
atgtaccatttgtagtagtagctgaacggtttctatattacataatttaacttaaaccattttcatgcagtgtatcaaacttttgttattgatacttgtt |
216 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18717543 |
atgtaccattt---gtagtagctaaacggtttctatgttacataatttaacttaaaccattttcatgcagtgtatcaaacttttgttattgatacttgtt |
18717639 |
T |
|
| Q |
217 |
tgcagaaaattacaattgccct |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18717640 |
tgcagaaaattacaattgccct |
18717661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University